glra1

Ensembl ID:
ENSDARG00000012019
ZFIN ID:
ZDB-GENE-991117-1
Description:
Glycine receptor subunit alphaZ1 [Source:UniProtKB/Swiss-Prot;Acc:O93430]
Human Orthologue:
GLRA1
Human Description:
glycine receptor, alpha 1 [Source:HGNC Symbol;Acc:4326]
Mouse Orthologue:
Glra1
Mouse Description:
glycine receptor, alpha 1 subunit Gene [Source:MGI Symbol;Acc:MGI:95747]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42393 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42394 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005499 Essential Splice Site 16 444 None 9
ENSDART00000047680 Essential Splice Site 16 458 None 10
ENSDART00000066197 Essential Splice Site 16 459 None 11
ENSDART00000136733 Essential Splice Site 16 457 None 10
Genomic Location (Zv9):
Chromosome 14 (position 26827301)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25520503
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGTTCGCACTCGGGATTTATTTGTGGGAAACTATTGTATTTTTCAGG[T/A]ACGTATCACCTTGTTTTGATGCAAAAGTGTTATTGTTTTTTACTCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005499 Nonsense 233 444 7 9
ENSDART00000047680 Nonsense 247 458 8 10
ENSDART00000066197 Nonsense 248 459 9 11
ENSDART00000136733 Nonsense 246 457 8 10
Genomic Location (Zv9):
Chromosome 14 (position 26889635)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25582837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGCCAATGAAAATCACATACTCTCTGTGTTTCAGGGAAGTTCACCTG[C/A]ATAGAGGCTCGATTCCACTTGGAGAGACAGATGGGCTATTATCTGATCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link