LOC565975

Ensembl ID:
ENSDARG00000012016
Human Orthologue:
HPGD
Human Description:
hydroxyprostaglandin dehydrogenase 15-(NAD) [Source:HGNC Symbol;Acc:5154]
Mouse Orthologue:
Hpgd
Mouse Description:
hydroxyprostaglandin dehydrogenase 15 (NAD) Gene [Source:MGI Symbol;Acc:MGI:108085]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7243 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018533 Essential Splice Site 141 261 4 7
Genomic Location:
Chromosome 1 (position 38822157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTACGGAAAGCAAGGAGGGGCAATCATCAACGTCTCGTCTATGGCAGG[T/G]GAGCTGCTGAAAACTTTACCATGCTTCTTATATATTGTTTTTAAAAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t8jwxfcu