cpa6

Ensembl ID:
ENSDARG00000012013
ZFIN ID:
ZDB-GENE-091204-331
Human Orthologue:
CPA6
Human Description:
carboxypeptidase A6 [Source:HGNC Symbol;Acc:17245]
Mouse Orthologue:
Cpa6
Mouse Description:
carboxypeptidase A6 Gene [Source:MGI Symbol;Acc:MGI:3045348]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1089 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa1089
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106188 Nonsense 139 442 4 11
ENSDART00000134518 None None 69 None 3
ENSDART00000144244 Nonsense 139 175 4 5
ENSDART00000147748 Nonsense 139 217 4 6
Genomic Location:
Chromosome 24 (position 19447397)
KASP Assay ID:
554-0991.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGGGTACCGGTCCTCTAGGAAGCGCAGATCTGAACTTCAGTATGACTA[T/G]GAAGTGTACCATCCTTTAGAAGAGGTGAGCAMATGGCTGACAAGTAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/n7jea5n9