cpa6

Ensembl ID:
ENSDARG00000012013
ZFIN ID:
ZDB-GENE-091204-331
Human Orthologue:
CPA6
Human Description:
carboxypeptidase A6 [Source:HGNC Symbol;Acc:17245]
Mouse Orthologue:
Cpa6
Mouse Description:
carboxypeptidase A6 Gene [Source:MGI Symbol;Acc:MGI:3045348]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30080 Nonsense Mutation detected in F1 DNA During 2016
sa1089 Nonsense F2 line generated During 2016
sa37863 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106188 Nonsense 108 442 3 11
ENSDART00000134518   None 69 None 3
ENSDART00000144244 Nonsense 108 175 3 5
ENSDART00000147748 Nonsense 108 217 3 6
Genomic Location:
Chromosome 24 (position 19453863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAGACGCATTGGCTGAGAAATCATCTTCACCAAGAACACATCTACTA[C/A]GAGTGAGTCTCTTTTTCCACTGTTATAAGACTCCTGTGGGATAAATATCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1089
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106188 Nonsense 139 442 4 11
ENSDART00000134518   None 69 None 3
ENSDART00000144244 Nonsense 139 175 4 5
ENSDART00000147748 Nonsense 139 217 4 6
ENSDART00000106188 Nonsense 139 442 4 11
ENSDART00000134518   None 69 None 3
ENSDART00000144244 Nonsense 139 175 4 5
ENSDART00000147748 Nonsense 139 217 4 6
Genomic Location:
Chromosome 24 (position 19447397)
KASP Assay ID:
554-0991.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGGGTACCGGTCCTCTAGGAAGCGCAGATCTGAACTTCAGTATGACTA[T/G]GAAGTGTACCATCCTTTAGAAGAGGTGAGCAMATGGCTGACAAGTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106188 Nonsense 139 442 4 11
ENSDART00000134518   None 69 None 3
ENSDART00000144244 Nonsense 139 175 4 5
ENSDART00000147748 Nonsense 139 217 4 6
ENSDART00000106188 Nonsense 139 442 4 11
ENSDART00000134518   None 69 None 3
ENSDART00000144244 Nonsense 139 175 4 5
ENSDART00000147748 Nonsense 139 217 4 6
Genomic Location:
Chromosome 24 (position 19447397)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGGGTACCGGTCCTCTAGGAAGCGCAGATCTGAACTTCAGTATGACTA[T/A]GAAGTGTACCATCCTTTAGAAGAGGTGAGCACATGGCTGACAAGTAACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link