fmn1

Ensembl ID:
ENSDARG00000011975
ZFIN ID:
ZDB-GENE-041001-198
Description:
Novel protein similar to vertebrate formin (Limb deformity) (FMN) [Source:UniProtKB/TrEMBL;Acc:Q5RIQ
Human Orthologue:
FMN1
Human Description:
formin 1 [Source:HGNC Symbol;Acc:3768]
Mouse Orthologue:
Fmn1
Mouse Description:
formin 1 Gene [Source:MGI Symbol;Acc:MGI:101815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11299 Nonsense Available for shipment Available now
sa1135 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa11299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019819 Nonsense 40 1303 1 13
ENSDART00000136804 None None 443 None 13
Genomic Location:
Chromosome 20 (position 29462790)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCACTGTCTGAGGAAAATACAAATATKATTAATTTTCACTCTTTGACT[G/T]GAAAAGGAGATGTTCATGGTCAACAAACATGTATTCAAAGGCAGGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1135
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019819 Nonsense 985 1303 5 13
ENSDART00000136804 Nonsense 69 443 2 13
Genomic Location:
Chromosome 20 (position 29471625)
KASP Assay ID:
554-1046.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCTAAAGCCACATCGCCCACCAAAAGAAAGCCCCTATCTGATGCCTA[T/A]GAGAAGAAAACCAAAGCCAGGAAGGTAGCACKCTTTCCTCAAGATCAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)
  • Orofacial clefts: Genome-wide association study identifies two susceptibility loci for nonsyndromic cleft lip with or without cleft palate. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6p75gatk