csrp2

Ensembl ID:
ENSDARG00000011961
ZFIN ID:
ZDB-GENE-040426-1863
Description:
cysteine and glycine-rich protein 2 [Source:RefSeq peptide;Acc:NP_957191]
Human Orthologue:
CSRP2
Human Description:
cysteine and glycine-rich protein 2 [Source:HGNC Symbol;Acc:2470]
Mouse Orthologue:
Csrp2
Mouse Description:
cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33360 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019508   None 193 5 5
ENSDART00000132581   None 193 6 6
ENSDART00000134123 Essential Splice Site None 193 6 7
Genomic Location (Zv9):
Chromosome 4 (position 2385569)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 2584448
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCAGGAGCTCTGGTTCACGCTCAATGACAGTCCTTCTGTTTTGTAAAG[G/A]TTGTTAATAATTTCAAGATAATGATTATTTTGCATAAAGGAAAAGAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link