ctnnbl1

Ensembl ID:
ENSDARG00000011958
ZFIN ID:
ZDB-GENE-040426-1850
Description:
beta-catenin-like protein 1 [Source:RefSeq peptide;Acc:NP_957160]
Human Orthologue:
CTNNBL1
Human Description:
catenin, beta like 1 [Source:HGNC Symbol;Acc:15879]
Mouse Orthologue:
Ctnnbl1
Mouse Description:
catenin, beta like 1 Gene [Source:MGI Symbol;Acc:MGI:1913892]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17860 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015535 Essential Splice Site 220 563 6 16
Genomic Location:
Chromosome 2 (position 54318983)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGACGAGACTGTGAAGGAGGAAGCTGATGGAGTTTACAACACTTTAGG[T/A]AAGACAGAAMKACACTCCAGCCAGCKAATTAATGCACAKGTCAATCTGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hip geometry: Genome-wide association with bone mass and geometry in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jruw7jio