ctnnbl1

Ensembl ID:
ENSDARG00000011958
ZFIN ID:
ZDB-GENE-040426-1850
Description:
beta-catenin-like protein 1 [Source:RefSeq peptide;Acc:NP_957160]
Human Orthologue:
CTNNBL1
Human Description:
catenin, beta like 1 [Source:HGNC Symbol;Acc:15879]
Mouse Orthologue:
Ctnnbl1
Mouse Description:
catenin, beta like 1 Gene [Source:MGI Symbol;Acc:MGI:1913892]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17860 Essential Splice Site Available for shipment Available now
sa39952 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33055 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015535 Essential Splice Site 220 563 6 16
Genomic Location (Zv9):
Chromosome 2 (position 54318983)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 54279813
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGACGAGACTGTGAAGGAGGAAGCTGATGGAGTTTACAACACTTTAGG[T/A]AAGACAGAAMKACACTCCAGCCAGCKAATTAATGCACAKGTCAATCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015535 Essential Splice Site 344 563 10 16
Genomic Location (Zv9):
Chromosome 2 (position 54335926)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 54296756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGTTTCCTCAGGGGGGAGGGGCTTCAGCTCATGAACCTCATGCTCAGG[T/C]AAAACTGATTTTCTTTCTTGCTGAAATTCAGGATCTGTGTCTTTATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015535 Nonsense 422 563 12 16
Genomic Location (Zv9):
Chromosome 2 (position 54368798)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 54329628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACGTGTGCTCCATCATCGCCTCCATGCTGAGGAACCTGAAAGGGCAG[C/T]AGAGAAGTCGACTGCTCAGCAAATTCACAGAGAACGACTGCGAGAAGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hip geometry: Genome-wide association with bone mass and geometry in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link