dlx4a

Ensembl ID:
ENSDARG00000011956
ZFIN ID:
ZDB-GENE-980526-73
Description:
Homeobox protein Dlx4a [Source:UniProtKB/Swiss-Prot;Acc:Q98879]
Human Orthologues:
DLX1, DLX6
Human Descriptions:
distal-less homeobox 1 [Source:HGNC Symbol;Acc:2914]
distal-less homeobox 6 [Source:HGNC Symbol;Acc:2919]
Mouse Orthologues:
Dlx1, Dlx6
Mouse Descriptions:
distal-less homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:94901]
distal-less homeobox 6 Gene [Source:MGI Symbol;Acc:MGI:101927]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40108 Nonsense Mutation detected in F1 DNA During 2017
sa2124 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa40108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007073 Nonsense 55 250 1 4
ENSDART00000133457 Nonsense 55 250 1 3
Genomic Location (Zv9):
Chromosome 3 (position 34755711)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34540907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGCGCACTATCCGGTGCACGGTTTGCATCAAGGCGCGCATTCGCAATA[C/A]GACGCGGCCTTCTCTCCTGGCGCTGCGTCTTACAGCCGTCCACTCGCTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2124
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007073 Nonsense 228 250 3 4
ENSDART00000133457 Nonsense 228 250 3 3
Genomic Location (Zv9):
Chromosome 3 (position 34766381)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 34551577
KASP Assay ID:
554-3326.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGATGTTTCCATGCCCAGCAAAGGTGCTCCCATCCACTCTGGAGGATA[T/A]ATGAACTCTTTCGGACACTGGTACTCGGGTCATCATCAAGACCCAATGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link