si:dkey-114g7.2

Ensembl ID:
ENSDARG00000011955
ZFIN ID:
ZDB-GENE-060503-803
Description:
Novel protein similar to vertebrate chaperone, ABC1 activity of bc1 complex like (S. pombe) (CABC1)
Human Orthologue:
ADCK4
Human Description:
aarF domain containing kinase 4 [Source:HGNC Symbol;Acc:19041]
Mouse Orthologue:
Adck4
Mouse Description:
aarF domain containing kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1924139]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35821 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24977 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32019 Nonsense Available for shipment Available now
sa6367 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35821
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006829 Essential Splice Site 1 624 None 15
ENSDART00000140621 Essential Splice Site 1 623 None 15
ENSDART00000006829 Essential Splice Site 1 624 None 15
ENSDART00000140621 Essential Splice Site 1 623 None 15
Genomic Location (Zv9):
Chromosome 15 (position 13608057)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14653654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGACACTTCATAGAGACGCTGAGGAGACTCTAAACTCTCAATACGAG[T/A]AAGTAACGATAACATTACTGGTAGGAAACTACACTGCTGTGATAATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006829 Essential Splice Site 1 624 None 15
ENSDART00000140621 Essential Splice Site 1 623 None 15
ENSDART00000006829 Essential Splice Site 1 624 None 15
ENSDART00000140621 Essential Splice Site 1 623 None 15
Genomic Location (Zv9):
Chromosome 15 (position 13608057)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14653654
KASP Assay ID:
554-7318.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGACACTTCATAGAGACGCTGAGGAGACTCTAAACTCTCAATACGAG[T/A]AAGTAACGATAACATTACTGGTAGGAAACTACACTGCTGTGATAATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006829 Nonsense 85 624 3 15
ENSDART00000140621 Nonsense 85 623 3 15
Genomic Location (Zv9):
Chromosome 15 (position 13626520)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14635191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGAATTGAGAAGTGGGAGGAGATGGACCTGGATGAAGCTGCAAAGTG[G/A]TCGGTCGCCTCAGAAATGCCACCAGACTTTTCCAGTAAAGACGGAAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6367
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006829 Nonsense 316 624 8 15
ENSDART00000140621 Nonsense 316 623 8 15
Genomic Location (Zv9):
Chromosome 15 (position 13633410)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14628301
KASP Assay ID:
554-5016.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAACTCTCATCAWTTGAGGAAAAGCCTTTTGCTGCTGCCTCCATTGGA[C/T]AAGTTCATCATGGAGTTTTGCCTGRTGGGAAGGAAATCGCTATGAAGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link