insra

Ensembl ID:
ENSDARG00000011948
ZFIN ID:
ZDB-GENE-020503-3
Description:
insulin receptor a [Source:RefSeq peptide;Acc:NP_001136144]
Human Orthologue:
INSR
Human Description:
insulin receptor [Source:HGNC Symbol;Acc:6091]
Mouse Orthologue:
Insr
Mouse Description:
insulin receptor Gene [Source:MGI Symbol;Acc:MGI:96575]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6016 Nonsense Mutation detected in F1 DNA During 2014
sa1682 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008302 Nonsense 687 1353 10 21

The following transcripts of ENSDARG00000011948 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37284943)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCCCCACACAAGTGGACAACGAAGAGGAGCAGAAGTGGAACCAAACT[G/T]AGGAGCAGGGCCCTGATAGCCGCTGCTGCGCTTGTCCTAAAACAGAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1682
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008302 Essential Splice Site 824 1353 11 21

The following transcripts of ENSDARG00000011948 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37279993)
KASP Assay ID:
554-1628.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCGATGCAGTATGGCAGCCTACGTCAGTGCCCGCACCATGCCTGAAG[G/A]TAGAGGATTTTTATTTATGATGCAGTGTTATTGTTTAGAATGTAGCTATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j40fgmz1