bmpr2a

Ensembl ID:
ENSDARG00000011941
ZFIN ID:
ZDB-GENE-070618-1
Description:
bone morphogenetic protein receptor, type II a (serine/threonine kinase) [Source:RefSeq peptide;Acc
Human Orthologue:
BMPR2
Human Description:
bone morphogenetic protein receptor, type II (serine/threonine kinase) [Source:HGNC Symbol;Acc:1078]
Mouse Orthologue:
Bmpr2
Mouse Description:
bone morphogenic protein receptor, type II (serine/threonine kinase) Gene [Source:MGI Symbol;Acc:MGI

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40652 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056764 Nonsense 800 1003 12 13

The following transcripts of ENSDARG00000011941 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 12715316)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 12568538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAGCCAACGAGGACTTGACCTTCGGCCTCTTAAACACCAGTCCCGAT[G/T]AGCAGGAGCCTCTGCTGAGAAGAGAGGCGCATCCTGACAATGCAAACAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link