gyg1

Ensembl ID:
ENSDARG00000011934
ZFIN ID:
ZDB-GENE-040426-2910
Description:
glycogenin 1 [Source:RefSeq peptide;Acc:NP_998675]
Human Orthologue:
GYG1
Human Description:
glycogenin 1 [Source:HGNC Symbol;Acc:4699]
Mouse Orthologue:
Gyg
Mouse Description:
glycogenin Gene [Source:MGI Symbol;Acc:MGI:1351614]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu3302 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu3302
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025962 Nonsense 128 329 4 7
Genomic Location (Zv9):
Chromosome 2 (position 24709441)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25284218
KASP Assay ID:
554-0002.2 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGAATTATTTGAGAGAGAGGAGCTTTCTGCTGCACCAGATCCTGGCT[G/A]GCCTGATTGCTTCAACTCTGGTGTGTTTGTCTTCCGCCCCTCCAATGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link