prkcbp1l

Ensembl ID:
ENSDARG00000011932
ZFIN ID:
ZDB-GENE-030131-2199
Description:
protein kinase C binding protein 1, like [Source:RefSeq peptide;Acc:NP_955935]
Human Orthologue:
ZMYND8
Human Description:
zinc finger, MYND-type containing 8 [Source:HGNC Symbol;Acc:9397]
Mouse Orthologue:
Zmynd8
Mouse Description:
zinc finger, MYND-type containing 8 Gene [Source:MGI Symbol;Acc:MGI:1918025]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24261 Nonsense Available for shipment Available now
sa37626 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24261
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005015 Nonsense 67 1111 4 20
ENSDART00000124510 Nonsense 87 1131 4 20
Genomic Location (Zv9):
Chromosome 23 (position 9952849)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9910990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTTGCCTGCATTTCAGTGTGAGCTCAGACATGGTCCCTTTTACTA[T/A]GTCAAGCAGCCCGCACTCACCACAGACCCTGTTGATGTTGTACCGCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005015 Nonsense 741 1111 15 20
ENSDART00000124510 Nonsense 761 1131 15 20
Genomic Location (Zv9):
Chromosome 23 (position 9930473)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 9888614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGAATCTTCCTCTGTTTTAGGCAAATCTTCTACTTCTACCAGCGTTT[C/A]AGCTTCTCCTTCTACGGATACCACTTCATCTTCATCCTCCAATCCTGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link