itpr2

Ensembl ID:
ENSDARG00000011909
ZFIN ID:
ZDB-GENE-050419-192
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8HAL5]
Human Orthologue:
ITPR2
Human Description:
inositol 1,4,5-triphosphate receptor, type 2 [Source:HGNC Symbol;Acc:6181]
Mouse Orthologue:
Itpr2
Mouse Description:
inositol 1,4,5-triphosphate receptor 2 Gene [Source:MGI Symbol;Acc:MGI:99418]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa794 Essential Splice Site Available for shipment Available now
sa13636 Essential Splice Site Available for shipment Available now
sa14152 Essential Splice Site Available for shipment Available now
sa10652 Nonsense Available for shipment Available now
sa9038 Nonsense Mutation detected in F1 DNA During 2014
sa23267 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa794
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061134 Essential Splice Site 31 1947 1 42
Genomic Location:
Chromosome 18 (position 15616779)
KASP Assay ID:
554-0699.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTCTGTATGCGGAGGGAACTGTCAATGGATTTATCAGCACTTTAGGG[T/G]GAGTTACTGTACCTTCCAGTGTTTAGTGCATTGCTCTTAAAGATTTGTAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061134 Essential Splice Site 236 1947 7 42
ENSDART00000061134 Essential Splice Site 236 1947 7 42
Genomic Location:
Chromosome 18 (position 15641937)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGCTCTTCAWGAAGTTCAGTGAATACAGAGATGATAYTTTAAAAGGGG[T/C]GAGTCTTYTGCATGTGTGMACTGATGCGTTRTTGGTTTGGGTTTGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061134 Essential Splice Site 236 1947 7 42
ENSDART00000061134 Essential Splice Site 236 1947 7 42
Genomic Location:
Chromosome 18 (position 15641937)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGCTCTTCAWGAAGTTCAGTGAATACAGAGATGATAYTTTAAAAGGGG[T/C]GAGTCTTYTGCATGTGTGMACTGATGCGTTRTTGGTTTGGGTTTGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061134 Nonsense 1332 1947 31 42
Genomic Location:
Chromosome 18 (position 15676255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAAAGCATGATGTGTTCAGGGCTGGATGAGACGGGGGCTCTGATGTA[T/G]CACATCACCYTGGTGGAGCTGCTGGCCGCCTGCACTGAGGGCAAGAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061134 Nonsense 1541 1947 35 42
Genomic Location:
Chromosome 18 (position 15680378)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGCATGGTGCAGCGAGCGGTTAAAGACTGGAGGCTGTCAGCCCGTGGA[C/T]GACCCCGCAAGGARCCCTTTGGAGCACATGATTACAAGATCATTGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23267
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061134 Nonsense 1892 1947 42 42
Genomic Location:
Chromosome 18 (position 15721325)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTTGTATACAGAACTTTCTGCGAGATCAGAACAACAAAACCAATTA[T/A]AACCTGGTGTGTGAGACGCTGCAGTTTCTCGACTGTATCTGCGGCAGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vzz88alv