cry4

Ensembl ID:
ENSDARG00000011890
ZFIN ID:
ZDB-GENE-010426-7
Description:
cryptochrome 4 [Source:RefSeq peptide;Acc:NP_571862]
Human Orthologues:
CRY1, CRY2
Human Descriptions:
cryptochrome 1 (photolyase-like) [Source:HGNC Symbol;Acc:2384]
cryptochrome 2 (photolyase-like) [Source:HGNC Symbol;Acc:2385]
Mouse Orthologues:
Cry1, Cry2
Mouse Descriptions:
cryptochrome 1 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270841]
cryptochrome 2 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270859]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8815 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8815
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082365 Nonsense 53 418 2 9
ENSDART00000105873 Nonsense 74 579 2 11
ENSDART00000121551 Nonsense 53 418 2 10
ENSDART00000126053 Nonsense 74 582 2 12
Genomic Location:
Chromosome 22 (position 811602)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGGACCGTGTGTTCCTGCAGGGGGCRATGCACATGGGTGCGYTACGCT[G/A]GCGGTTTCTTCTCCAGAGTCTGGAGGATCTGGACACTCGTCTGCRGGCGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m6rb3xfj