pdca

Ensembl ID:
ENSDARG00000011886
ZFIN ID:
ZDB-GENE-031023-1
Description:
Pdc1 protein [Source:UniProtKB/TrEMBL;Acc:Q6P968]
Human Orthologue:
PDC
Human Description:
phosducin [Source:HGNC Symbol;Acc:8759]
Mouse Orthologue:
Pdc
Mouse Description:
phosducin Gene [Source:MGI Symbol;Acc:MGI:98090]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32893 Nonsense Mutation detected in F1 DNA During 2017
sa39809 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007654 Nonsense 61 245 2 3
Genomic Location (Zv9):
Chromosome 2 (position 20683333)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21229271
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGTATCCCTTCCAACAAGAGAGAGCTCCTCAGACAGATGTCCAACCCT[A/T]AATCCAGTGATGACCCACGGGAAAAAGTGAACCGCAAGGTAATCACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007654 Essential Splice Site 73 245 2 3
Genomic Location (Zv9):
Chromosome 2 (position 20683294)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21229232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCAACCCTAAATCCAGTGATGACCCACGGGAAAAAGTGAACCGCAAG[G/A]TAATCACAGAAACATATTGTCAACCTTATTTGTCCCAATACAGTTGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link