mrpl19

Ensembl ID:
ENSDARG00000011885
ZFIN ID:
ZDB-GENE-040801-55
Description:
39S ribosomal protein L19, mitochondrial [Source:RefSeq peptide;Acc:NP_001003544]
Human Orthologue:
MRPL19
Human Description:
mitochondrial ribosomal protein L19 [Source:HGNC Symbol;Acc:14052]
Mouse Orthologue:
Mrpl19
Mouse Description:
mitochondrial ribosomal protein L19 Gene [Source:MGI Symbol;Acc:MGI:1926274]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23704 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018049 Essential Splice Site 208 281 None 6
ENSDART00000124388 Essential Splice Site 218 291 None 6
ENSDART00000145034 Essential Splice Site 206 279 None 6
Genomic Location:
Chromosome 20 (position 25470852)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCAACCTGTCCATTATGAGCTCACGAAAGACATCCCAGTCAATCCGG[T/C]AGGACATTTCAGTCAAACATCTTTATCTGTGATGTTCTGTAATGTTATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f7t9dcgy