MFN1 (4 of 4)

Ensembl ID:
ENSDARG00000011884
Description:
mitofusin 1 [Source:HGNC Symbol;Acc:18262]
Human Orthologue:
MFN1
Human Description:
mitofusin 1 [Source:HGNC Symbol;Acc:18262]
Mouse Orthologue:
Mfn1
Mouse Description:
mitofusin 1 Gene [Source:MGI Symbol;Acc:MGI:1914664]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39754 Nonsense Mutation detected in F1 DNA During 2016
sa12728 Nonsense Available for shipment Available now
sa19663 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026201 Nonsense 134 527 4 13
Genomic Location:
Chromosome 2 (position 4571164)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAGTCTGCCGTCAAGACCAAGTTTGAGCAGCACACAATCCGAGCCTGG[C/T]AGATCATTGAGTCGGTCAAGGCTATCATGGATGCCATCAATATTTCTTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026201 Nonsense 460 527 11 13
Genomic Location:
Chromosome 2 (position 4559346)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGGCCGTCGCACACWTCATCAGTGGAGACTCTGGTCAGCAGGTGCAA[C/T]AGTAAGTGCCAAYAATAATCWAATATTCATTCATTNNNNTTCTTGTCGGCTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026201 Nonsense 472 527 12 13
Genomic Location:
Chromosome 2 (position 4555339)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCTCTGTCTGCAGGGAGATGGTGGCCGTCTTTGCCCGCATGTGCCAA[C/T]AGGTCGACAAGAGCGAGATGGAGCTTGAAACGGAGATCCGCAGACTCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link