ednra

Ensembl ID:
ENSDARG00000011876
ZFIN ID:
ZDB-GENE-010906-2
Description:
endothelin-1 receptor [Source:RefSeq peptide;Acc:NP_001092915]
Human Orthologue:
EDNRA
Human Description:
endothelin receptor type A [Source:HGNC Symbol;Acc:3179]
Mouse Orthologue:
Ednra
Mouse Description:
endothelin receptor type A Gene [Source:MGI Symbol;Acc:MGI:105923]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19531 Essential Splice Site Available for shipment Available now
sa1973 Nonsense F2 line generated During 2014
sa4855 Nonsense Mutation detected in F1 DNA During 2014
sa11317 Nonsense Available for shipment Available now
sa13839 Nonsense Available for shipment Available now
sa19532 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19531
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Essential Splice Site None 422 1 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 36373894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACTGACTGACTGACGGGATCCTGGGGAAGGCAGACATTTAAGGAGCG[G/A]TAGGTGAAAAACCAGGAGACATTTATAATTCATAAGTGTAGCAGTTTACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1973
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 20 422 2 8
ENSDART00000128557 Nonsense 20 24 2 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 36382796)
KASP Assay ID:
554-2675.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGACGCTACAATTGTTTCTGCTAATGGCCGTTCTGGCCACTGGTGGAT[T/A]ATGTCTGATAAAYGGCACAGAGGAAGCCCAGGATGCTTTATATCCAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 66 422 2 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 36382935)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCCCACAAAAAAAGACGCTTCGGTTTTCAATATGAAGCATCCACCCTG[T/A]AGGGATCCCACTTCCATCAAGCTTTATTTTAAGTATATCAACACAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 163 422 3 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 36391010)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACAGCTCCTTTGGWCTCTTCCTGTGCAAACTTGTGCCATTCCTCCAR[A/T]AAGCGTCTGTTGGGATTACAGTGCTCAATCWATGTGCTTTGAGTGTGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 189 422 4 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 36399013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATGTTTTGMATGTCTCAATCAGGTACAGGGCTGTAGYCTCCTGGAGC[A/T]GAGTGCAGGGGGTCGGCGTTCCTCTTCTTACTGCCATCGAGATCTTCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010632 Nonsense 283 422 5 8
ENSDART00000128557 None None 24 None 2

The following transcripts of ENSDARG00000011876 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 36401303)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCACGGCTATTTTCTACACACTCATGACCTGTGAAATGCTGCATCAC[A/T]GAGATGGAAGCCTTCGCATCGCCCTCAGTGAACACCTTAAGCAGGTAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Carotid intima media thickness: Meta-analysis of genome-wide association studies from the CHARGE consortium identifies common variants associated with carotid intima media thickness and plaque. (View Study)
  • Dental caries: GWAS of dental caries patterns in the permanent dentition. (View Study)
  • Intracranial aneurysm: Genome-wide association study for intracranial aneurysm in the Japanese population identifies three candidate susceptible loci and a functional genetic variant at EDNRA. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0ugd30ms