inaa

Ensembl ID:
ENSDARG00000011862
ZFIN ID:
ZDB-GENE-060531-65
Description:
internexin neuronal intermediate filament protein, alpha [Source:RefSeq peptide;Acc:NP_001138256]
Human Orthologue:
INA
Human Description:
internexin neuronal intermediate filament protein, alpha [Source:HGNC Symbol;Acc:6057]
Mouse Orthologue:
Ina
Mouse Description:
internexin neuronal intermediate filament protein, alpha Gene [Source:MGI Symbol;Acc:MGI:96568]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22318 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22318
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027213 Nonsense 389 474 2 3
Genomic Location (Zv9):
Chromosome 13 (position 28901806)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 28547754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCAGAGAATATCAAGATCTCTTGAACGTCAAGATGGCATTAGACATT[G/T]AAATTGCAGCATACAGGTAAAGCACTGATTAATTAGTCATACTGTTCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Migraine: Genome-wide association analysis identifies susceptibility loci for migraine without aura. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link