map2k5

Ensembl ID:
ENSDARG00000011851
ZFIN ID:
ZDB-GENE-030131-1517
Description:
dual specificity mitogen-activated protein kinase kinase 5 [Source:RefSeq peptide;Acc:NP_001107789]
Human Orthologue:
MAP2K5
Human Description:
mitogen-activated protein kinase kinase 5 [Source:HGNC Symbol;Acc:6845]
Mouse Orthologue:
Map2k5
Mouse Description:
mitogen-activated protein kinase kinase 5 Gene [Source:MGI Symbol;Acc:MGI:1346345]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20994 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3631 Nonsense Mutation detected in F1 DNA During 2014
sa18875 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20993 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20992 Essential Splice Site Mutation detected in F1 DNA During 2014
sa17068 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052404 Essential Splice Site 120 450 5 22
Genomic Location:
Chromosome 7 (position 35394467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCAGCCGGTAAGACCCCAGGGATCCGCAACATTCACGGCCTGAAGG[T/C]ATGTGTCTCAATGATTGTTTCAGCAGAGTTGGGTATGGATCGGTTATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052404 Nonsense 128 450 6 22
Genomic Location:
Chromosome 7 (position 35390394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGTGATTGTCTTTGTTTGCCCGCAGGTGAACACGCGGCCCGAATCCT[C/A]GAGTGGCAGGAGCTCCTCTGCAGCTGATTCCCGCTCCAGCGATAGGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052404 Essential Splice Site 246 450 11 22
Genomic Location:
Chromosome 7 (position 35361942)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTCTTTGTGGAGAACAGAATATCGATATGCACTGAGTTTATGGATGG[T/G]AAGTCTCATTTGCTTAGACATTGTCAGGCATCTGGGATTCAACATTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052404 Essential Splice Site 378 450 19 22
Genomic Location:
Chromosome 7 (position 35346731)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCCCTCTATCGCAGCCTCTTCAGTTATTGCAGTGCATTGTTGATGAGG[T/C]GAGTCTGTGTCCCATGTACGAAACCGTCCCTAATGGTGTGGAAAGCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052404 Essential Splice Site 399 450 20 22
ENSDART00000052404 Essential Splice Site 399 450 20 22
Genomic Location:
Chromosome 7 (position 35331864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGTTGGTCAGTTCAGTGAGAAATTTGTCCACTTCATTACACAATGG[T/A]GAGTGTTTCTAATAACGAACACCTGTTTCTTCCTTTTGTGCCTGTCATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000052404 Essential Splice Site 399 450 20 22
ENSDART00000052404 Essential Splice Site 399 450 20 22
Genomic Location:
Chromosome 7 (position 35331864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCAGTTGGTCAGTTCAGTGAGAAATTTGTCCACTTCWTTACACAATGG[T/G]GAGTGTTTCTAATAACGAACACCTGTTTCTTCCTTTTGTGYCTGTCATAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uo0rawj5