chn2

Ensembl ID:
ENSDARG00000011845
ZFIN ID:
ZDB-GENE-091020-5
Human Orthologue:
CHN2
Human Description:
chimerin (chimaerin) 2 [Source:HGNC Symbol;Acc:1944]
Mouse Orthologue:
Chn2
Mouse Description:
chimerin (chimaerin) 2 Gene [Source:MGI Symbol;Acc:MGI:1917243]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22814 Essential Splice Site Available for shipment Available now
sa22813 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014769 Essential Splice Site 245 466 None 13
ENSDART00000139776 Essential Splice Site 229 450 None 12

The following transcripts of ENSDARG00000011845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22442197)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20548640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGCTAACTTCATGTGGGGTCTCATCGCTCAGGGCGTCCGTTGTTCAGG[T/C]AACCCTCCACCAAACACACACAAATGAGTTATAGCATTGTCTATCGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22813
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014769 Nonsense 311 466 10 13
ENSDART00000139776 Nonsense 295 450 9 12

The following transcripts of ENSDARG00000011845 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 22412949)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 20519392
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTCATACTGTTCTTCTTCTTCCAGGTTTGAAATCAGAGGGTCTGTAC[A/T]GAGTGTCAGGCTTCACAGAACACATAGAAGATGTCCGACTGTCCTTCGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link