fgd4

Ensembl ID:
ENSDARG00000011830
ZFIN IDs:
ZDB-GENE-050420-347, ZDB-GENE-050420-347
Description:
FYVE, RhoGEF and PH domain containing 4 [Source:RefSeq peptide;Acc:NP_001171404]
Human Orthologue:
FGD4
Human Description:
FYVE, RhoGEF and PH domain containing 4 [Source:HGNC Symbol;Acc:19125]
Mouse Orthologue:
Fgd4
Mouse Description:
FYVE, RhoGEF and PH domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2183747]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23242 Nonsense Available for shipment Available now
sa23243 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018144 Nonsense 262 728 8 18
ENSDART00000125382 Nonsense 262 728 5 15
Genomic Location:
Chromosome 18 (position 11665042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCGCATTGGAGACATCCTACAGAAGCTCACGCCCTTCTTGAAGATGTA[T/A]GCAGAGTATGTGAGGAACTTTGATCATGCCATGGATCTGCTGAAGCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018144 Essential Splice Site 294 728 8 18
ENSDART00000125382 Essential Splice Site 294 728 5 15
Genomic Location:
Chromosome 18 (position 11665139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGATAGATCGCTCGCCTCCATTTAAAGCTATCATTCTGGATATACAG[G/T]TGAACACTGATGCAGATTGCTATTCTTGAAAAGAGTTCTTTTAAATAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/d3swrcoh