pbxip1b

Ensembl ID:
ENSDARG00000011824
ZFIN ID:
ZDB-GENE-070112-2032
Description:
pre-B-cell leukemia homeobox interacting protein 1 [Source:RefSeq peptide;Acc:NP_001073425]
Human Orthologue:
PBXIP1
Human Description:
pre-B-cell leukemia homeobox interacting protein 1 [Source:HGNC Symbol;Acc:21199]
Mouse Orthologue:
Pbxip1
Mouse Description:
pre-B-cell leukemia transcription factor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:24416

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36112 Nonsense Mutation detected in F1 DNA During 2017
sa31004 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16880 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36112
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020833 Nonsense 250 515 5 11
ENSDART00000088901 Nonsense 189 791 6 10
ENSDART00000123529 Nonsense 250 843 4 9
ENSDART00000125963 Nonsense 250 512 5 10
ENSDART00000127570 Nonsense 250 852 5 9
ENSDART00000141778   None 132 None 5
ENSDART00000145585 Nonsense 223 244 4 5
Genomic Location (Zv9):
Chromosome 16 (position 24945135)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22849451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGACTTTCAGCCGCCTCAAAGAGAAGAGGAAACTGTCTTTACTTTAAAC[A/T]AGTGTATCATCGCAGCTATCATTCTTCTAGGGCTTGGGACCATTTTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020833 Essential Splice Site 276 515 6 11
ENSDART00000088901   None 791 None 10
ENSDART00000123529   None 843 None 9
ENSDART00000125963 Essential Splice Site 276 512 6 10
ENSDART00000127570   None 852 None 9
ENSDART00000141778   None 132 None 5
ENSDART00000145585   None 244 None 5
Genomic Location (Zv9):
Chromosome 16 (position 24943103)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22847419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGAGACTCTGTTGTTCCACAGGTGTGCTCATGGATGCGGATGATGG[T/C]AGGGTGTGTGTGTGTGTGAGAGAGTGTGTGGAATGGAGCAATGAGATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020833   515 515 None 11
ENSDART00000088901   782 791 10 10
ENSDART00000123529 Essential Splice Site 843 843 8 9
ENSDART00000125963   None 512 None 10
ENSDART00000127570   843 852 9 9
ENSDART00000141778   None 132 None 5
ENSDART00000145585   None 244 None 5
Genomic Location (Zv9):
Chromosome 16 (position 24933398)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22837714
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACTTCCAGCAGAAGTGAARAAGGTTGAAGATTCTTCKAGGAAAAAAAG[G/A]KACATGTTGAAACTGTCGGGTYTGAKTTAATTTGCYGATTAATAATATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link