plod2

Ensembl ID:
ENSDARG00000011821
ZFIN ID:
ZDB-GENE-070326-1
Description:
procollagen-lysine,2-oxoglutarate 5-dioxygenase 2 isoform 1 [Source:RefSeq peptide;Acc:NP_001007378
Human Orthologue:
PLOD2
Human Description:
procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2 [Source:HGNC Symbol;Acc:9082]
Mouse Orthologue:
Plod2
Mouse Description:
procollagen lysine, 2-oxoglutarate 5-dioxygenase 2 Gene [Source:MGI Symbol;Acc:MGI:1347007]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24440 Nonsense Available for shipment Available now
sa1768 Nonsense Available for shipment Available now
sa39433 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005901 Nonsense 614 754 18 20
ENSDART00000106488 Nonsense 593 733 17 19

The following transcripts of ENSDARG00000011821 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 5387102)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5275595
KASP Assay ID:
2261-8378.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCATTAACTGTTGACTGATTATTGTCCTTCTTTTTATCTTCACAGGAT[A/T]AGCGTATCACCGGAGGCTACGAAAGCGTCCCGACAGATGACATTCATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005901 Nonsense 679 754 19 20
ENSDART00000106488 Nonsense 658 733 18 19

The following transcripts of ENSDARG00000011821 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 5391267)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5279760
KASP Assay ID:
554-1761.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGCGATTATGAACTTTGTGGTGAAGTACACTCCAGACAGACAAGCCTA[T/A]CTTCGACCACATCACGACTCCTCAACGTTCACCATTAACWTCGCTCTCAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa39433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005901 Nonsense 712 754 20 20
ENSDART00000106488 Nonsense 691 733 19 19

The following transcripts of ENSDARG00000011821 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 5393384)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5281877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTTGTGCTTCTTCTATTTCAGGGCGGAGGTTGTCGATTTCACAGATA[T/A]AACTGCTCCATAGAATCTCCTAGAAAAGGCTGGAGCTTCATGCATCCAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link