pcnx

Ensembl ID:
ENSDARG00000011819
ZFIN ID:
ZDB-GENE-081113-6
Description:
Novel protein similar to H.sapiens PCNX, pecanex homolog (Drosophila) (PCNX) [Source:UniProtKB/TrEMB
Human Orthologue:
PCNX
Human Description:
pecanex homolog (Drosophila) [Source:HGNC Symbol;Acc:19740]
Mouse Orthologue:
Pcnx
Mouse Description:
pecanex homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1891924]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31944 Nonsense Available for shipment Available now
sa35550 Nonsense Mutation detected in F1 DNA During 2017
sa14634 Nonsense Available for shipment Available now
sa16965 Nonsense Available for shipment Available now
sa22351 Nonsense Available for shipment Available now
sa28165 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015664 Nonsense 269 2292 6 37
ENSDART00000139593 Nonsense 241 2279 5 35
Genomic Location (Zv9):
Chromosome 13 (position 36505694)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35978263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACTCACAGTCTTTCCGAAAAGAGTCGTCTCGACCAAGAGGATTGCCT[C/T]GAACCTCAAGTTCTGCGGGATCTGCTTTTCCGGATCCTTCTCTGCCTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015664 Nonsense 1252 2292 21 37
ENSDART00000139593 Nonsense 1239 2279 19 35
Genomic Location (Zv9):
Chromosome 13 (position 36478368)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35950937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTGACTGATCTTGTCCTCTTTTATTTCTTCCAGCCATTTTTAAGCTA[T/A]GTTCTGTACGGTCTAGTCGGCTCGGTAGGGCTGTTAACTCACTACCTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015664 Nonsense 1292 2292 21 37
ENSDART00000139593 Nonsense 1279 2279 19 35
Genomic Location (Zv9):
Chromosome 13 (position 36478248)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35950817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCCTGGTACTGTTTTTYCCACCCGCTGCTCAAAACCAGAGAGTACTA[T/A]CAGWTCGAAATCCGGGGTGAGTCACTCCATCACACAAATATTTGTTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015664 Nonsense 1778 2292 31 37
ENSDART00000139593 Nonsense 1765 2279 29 35
Genomic Location (Zv9):
Chromosome 13 (position 36467139)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35939708
KASP Assay ID:
2260-6738.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGTGGYTAYGTKTTTGTGTTRTTACAGCAATCTGGAGTCAKTCCTGTA[T/A]GGGCTGCATGCCTTGTTTAAAGGTGATTTCCGGATCTCGTCWGTGAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22351
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015664 Nonsense 1911 2292 33 37
ENSDART00000139593 Nonsense 1898 2279 31 35
Genomic Location (Zv9):
Chromosome 13 (position 36464469)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35937038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGCATTTTCAGGTGAATAAGGAGTGTGTTCGTGGCCTGTGGGCAGGA[C/T]AGCAGCAGGAATTGGTGTTTTTACGAAACCGAAACCCGGAGCGTGGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015664 Nonsense 2146 2292 35 37
ENSDART00000139593 Nonsense 2133 2279 33 35
Genomic Location (Zv9):
Chromosome 13 (position 36462199)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35934768
KASP Assay ID:
2260-6736.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCTGGCCCCTCCAGCTCCCTCTCCGCTCACTCCATCCCGCCCTGCAAA[C/T]GACACGCACACACGCTCGCAGGCCTGCTGGGAAACGAGGCCTTAGTGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link