tbx24

Ensembl ID:
ENSDARG00000011785
ZFIN ID:
ZDB-GENE-020416-5
Description:
T-box 24 [Source:RefSeq peptide;Acc:NP_705952]
Human Orthologue:
TBX6
Human Description:
T-box 6 [Source:HGNC Symbol;Acc:11605]
Mouse Orthologue:
Tbx6
Mouse Description:
T-box 6 Gene [Source:MGI Symbol;Acc:MGI:102539]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38869 Nonsense Mutation detected in F1 DNA During 2016
sa17875 Nonsense Available for shipment Available now
sa41936 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38869
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013465 Nonsense 343 874 7 8
Genomic Location (Zv9):
Chromosome 12 (position 4601613)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3884335
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAACAAGCCTTCTTGACCTCTGAGATGCCCTCTTCAATGGAGAGTCAA[C/T]AACAGACAACCTCTGAAACTAACGTAAACAACGCACTGATGGATGAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013465 Nonsense 423 874 8 8
Genomic Location (Zv9):
Chromosome 12 (position 4601938)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3884660
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAAGTATTTCATCTCCACACTCTATGCCTGCATATTCCTCTATACCTT[C/A]AKCAGAGTATCCTGGCGTWAATTCCTCTACAGCTATGCCTGCATCTACRA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41936
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013465 Nonsense 511 874 8 8
Genomic Location (Zv9):
Chromosome 12 (position 4602202)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 3884924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCAGGTTGACTATTGACTCTGGCCAAAATCAGGTGGATGATGGAGGTT[T/A]GAGCTCAGCCAATGCGACAACTCCTGCAGTCCCAAACCCAACCCAAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link