tbx24

Ensembl ID:
ENSDARG00000011785
ZFIN ID:
ZDB-GENE-020416-5
Description:
T-box 24 [Source:RefSeq peptide;Acc:NP_705952]
Human Orthologue:
TBX6
Human Description:
T-box 6 [Source:HGNC Symbol;Acc:11605]
Mouse Orthologue:
Tbx6
Mouse Description:
T-box 6 Gene [Source:MGI Symbol;Acc:MGI:102539]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17875 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013465 Nonsense 423 874 8 8
Genomic Location:
Chromosome 12 (position 4601938)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAAGTATTTCATCTCCACACTCTATGCCTGCATATTCCTCTATACCTT[C/A]AKCAGAGTATCCTGGCGTWAATTCCTCTACAGCTATGCCTGCATCTACRA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wty6tvmu