cttnl

Ensembl ID:
ENSDARG00000011777
ZFIN IDs:
ZDB-GENE-040426-1610, ZDB-GENE-040715-3, ZDB-GENE-040715-3
Description:
Cortactin, like [Source:UniProtKB/TrEMBL;Acc:Q7SXH4]
Human Orthologue:
CTTN
Human Description:
cortactin [Source:HGNC Symbol;Acc:3338]
Mouse Orthologue:
Cttn
Mouse Description:
cortactin Gene [Source:MGI Symbol;Acc:MGI:99695]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17004 Essential Splice Site Available for shipment Available now
sa23395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17004
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008696 Essential Splice Site 95 534 3 16
ENSDART00000017053 Essential Splice Site 28 206 2 9
ENSDART00000058468 Essential Splice Site 28 504 2 16
Genomic Location (Zv9):
Chromosome 18 (position 49870694)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50922504
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGTGGATGAAGGAGCAGATGAYTGGGAAACTGACCCTGACTTTGAG[G/A]TACAAACCCCGACATTCCTCCTMCCCTTCATCTTCCTCTTCTCCTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008696 Nonsense 237 534 8 16
ENSDART00000017053   None 206 None 9
ENSDART00000058468 Nonsense 170 504 8 16
Genomic Location (Zv9):
Chromosome 18 (position 49874011)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50925821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCACTGGTTTCGGGGGCCGGTACGGTGTTCAGGCTGACCGTGTGGAT[C/T]AGAGCGCGGTGGGCTTCGAGTATCAGGGGAAAACAGAGAAGCACGAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link