si:dkey-11p6.1

Ensembl ID:
ENSDARG00000011769
ZFIN IDs:
ZDB-GENE-041210-191, ZDB-GENE-050417-55, ZDB-GENE-050417-55
Description:
carboxypeptidase M [Source:RefSeq peptide;Acc:NP_001017591]
Human Orthologue:
CPM
Human Description:
carboxypeptidase M [Source:HGNC Symbol;Acc:2311]
Mouse Orthologue:
Cpm
Mouse Description:
carboxypeptidase M Gene [Source:MGI Symbol;Acc:MGI:1917824]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6947 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014685 Nonsense 77 446 3 9
ENSDART00000131690 Nonsense 77 369 3 8

The following transcripts of ENSDARG00000011769 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 22685783)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 24029118
KASP Assay ID:
554-5386.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGTCAACATCCTAGAGAACACCGAACGGGCATCCCAGAATTCAAATA[T/A]GTGGGCAACATCCATGGAAACGAGGTAACTCTGTYTCTCATTTTCAGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link