si:dkey-200l5.3

Ensembl ID:
ENSDARG00000011743
ZFIN ID:
ZDB-GENE-091204-80
Human Orthologue:
PIGO
Human Description:
phosphatidylinositol glycan anchor biosynthesis, class O [Source:HGNC Symbol;Acc:23215]
Mouse Orthologue:
Pigo
Mouse Description:
phosphatidylinositol glycan anchor biosynthesis, class O Gene [Source:MGI Symbol;Acc:MGI:1861452]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34878 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13241 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34878
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022899 Essential Splice Site 256 1083 3 10
ENSDART00000135044 Essential Splice Site 250 1075 4 11
Genomic Location (Zv9):
Chromosome 10 (position 17783866)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17796212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACCCTGCGATGGCAGAAAAACTCTCCCAGATGGATGGAGTTATTAGG[T/G]TAGCTGCAGCCTCATTTATTTTCCTACATTCTGTCATGTTGTTAAGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022899 Nonsense 1035 1083 9 10
ENSDART00000135044 Nonsense 1027 1075 10 11
Genomic Location (Zv9):
Chromosome 10 (position 17788116)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17800462
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCAWCAGTTTGTGCTGCAGCCATCCTCAGGAGACATCTCATGGTGTG[G/A]AAAGTTTTTGCACCCAAGTGAGTCACCATCTCTTTCTCTATCTCTCTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link