u2af2b

Ensembl ID:
ENSDARG00000011740
ZFIN ID:
ZDB-GENE-040426-1881
Description:
U2 small nuclear RNA auxiliary factor 2b [Source:RefSeq peptide;Acc:NP_991252]
Human Orthologue:
U2AF2
Human Description:
U2 small nuclear RNA auxiliary factor 2 [Source:HGNC Symbol;Acc:23156]
Mouse Orthologue:
U2af2
Mouse Description:
U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2 Gene [Source:MGI Symbol;Acc:MGI:98886]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3012 Essential Splice Site F2 line generated During 2014
sa4790 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14700 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3012
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023571 Essential Splice Site 250 475 8 13
Genomic Location:
Chromosome 19 (position 10929353)
KASP Assay ID:
554-2772.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATCAGCCATTACCTGGCATGAGCGAGAACCCCAGCGTTTATGTGCCAG[G/A]TAAACCCACAATACAATTCTCTTCTAAGATATCAAACTACAACAAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023571 Essential Splice Site 277 475 9 13
Genomic Location:
Chromosome 19 (position 10928998)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACAAGCTGTTCATTGGAGGTTTACCAAACTATCTCAATGACGACCAG[G/A]TTGGTTACAAATGCTTTCTGGTTGAAAGTCTGTGACGCATGCATTGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023571 Nonsense 409 475 12 13
Genomic Location:
Chromosome 19 (position 10923793)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGTACGAGGAGATCGTGGAGGACGTCAAAGAGGAGTGCTCTAAATA[T/A]GGCCAGGTCAAGAGCATAGARATTCCCAGACCCGTCGATGGCCTTGATAW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wki097bf