clock

Ensembl ID:
ENSDARG00000011703
ZFIN ID:
ZDB-GENE-990630-14
Description:
circadian locomoter output cycles protein kaput [Source:RefSeq peptide;Acc:NP_571032]
Human Orthologue:
CLOCK
Human Description:
clock homolog (mouse) [Source:HGNC Symbol;Acc:2082]
Mouse Orthologue:
Clock
Mouse Description:
circadian locomotor output cycles kaput Gene [Source:MGI Symbol;Acc:MGI:99698]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39276 Essential Splice Site Mutation detected in F1 DNA During 2016
sa14713 Essential Splice Site Available for shipment Available now
sa23683 Nonsense Available for shipment Available now
sa17257 Nonsense Available for shipment Available now
sa37017 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Essential Splice Site 27 892 2 20
Genomic Location (Zv9):
Chromosome 20 (position 22216712)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22244879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATCTTTGATGGGTTGATGGAAGAAGATGAGAAGGACAAAGCAAAAAGG[T/C]GATTATACAAGTAAAACTTTATGATTTTAATTGCTCACAGCGATATCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Essential Splice Site 76 892 3 20
Genomic Location (Zv9):
Chromosome 20 (position 22217335)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22245502
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTYTACCATCCTACAGAAGAGCATCGACTTCCTGCGCAAGCACAAAG[G/A]TTACTCTTGTTGCATAACAATTATTGTTTATYATTTGGAAAATTTAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23683
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Nonsense 203 892 7 20
Genomic Location (Zv9):
Chromosome 20 (position 22222543)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22250710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATGCTCCGGGGCACCATCGACCCCAAAGAGCCGCCCGTTTATGAATA[T/A]GTCAAGTTCATCGGAAACTTTAAGTCCCTCAACACTGGTGAGTGTCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Nonsense 414 892 13 20
Genomic Location (Zv9):
Chromosome 20 (position 22232759)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22260926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCTCCGAGTCTCAGTTGAACACCWCCAGCTTGAAGGAGGCSCTAGAG[C/T]GATTCGATCACAGCCGCACACCCTCAGCCTCKTCACGCAGCTCCCGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37017
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Splice Site, Nonsense 476 892 15 20
Genomic Location (Zv9):
Chromosome 20 (position 22235745)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 22263912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAGTTTGTCTCTGTTCAGGCTGTTTACTCTTGTGTTTGTGTGTTCAGT[C/A]GATGAGTTCTCAGACCACAGGACAGACGATGGGAACATCTCTTGTGTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link