clock

Ensembl ID:
ENSDARG00000011703
ZFIN ID:
ZDB-GENE-990630-14
Description:
circadian locomoter output cycles protein kaput [Source:RefSeq peptide;Acc:NP_571032]
Human Orthologue:
CLOCK
Human Description:
clock homolog (mouse) [Source:HGNC Symbol;Acc:2082]
Mouse Orthologue:
Clock
Mouse Description:
circadian locomotor output cycles kaput Gene [Source:MGI Symbol;Acc:MGI:99698]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14713 Essential Splice Site Available for shipment Available now
sa23683 Nonsense Mutation detected in F1 DNA During 2014
sa17257 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Essential Splice Site 76 892 3 20
Genomic Location:
Chromosome 20 (position 22217335)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGTYTACCATCCTACAGAAGAGCATCGACTTCCTGCGCAAGCACAAAG[G/A]TTACTCTTGTTGCATAACAATTATTGTTTATYATTTGGAAAATTTAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Nonsense 203 892 7 20
Genomic Location:
Chromosome 20 (position 22222543)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATGCTCCGGGGCACCATCGACCCCAAAGAGCCGCCCGTTTATGAATA[T/A]GTCAAGTTCATCGGAAACTTTAAGTCCCTCAACACTGGTGAGTGTCAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025575 Nonsense 414 892 13 20
Genomic Location:
Chromosome 20 (position 22232759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCTCCGAGTCTCAGTTGAACACCWCCAGCTTGAAGGAGGCSCTAGAG[C/T]GATTCGATCACAGCCGCACACCCTCAGCCTCKTCACGCAGCTCCCGCAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4g9i2bi9