prtfdc1

Ensembl ID:
ENSDARG00000011683
ZFIN ID:
ZDB-GENE-980526-324
Description:
phosphoribosyl transferase domain containing 1 [Source:RefSeq peptide;Acc:NP_955812]
Human Orthologue:
PRTFDC1
Human Description:
phosphoribosyl transferase domain containing 1 [Source:HGNC Symbol;Acc:23333]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14170 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14170
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013454 Essential Splice Site 169 225 6 9
Genomic Location (Zv9):
Chromosome 2 (position 12077568)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 12482230
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTGGATCACGTTGAAGCCTTCAAGCCYAAGATGATAAAAGTAGCTGG[G/T]TGAGACTAATAGATTAATACRGGCCTTCTTTACCCAAAACTTTGAGTGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link