si:ch211-246m6.5

Ensembl ID:
ENSDARG00000011673
ZFIN ID:
ZDB-GENE-050208-577
Description:
Novel protein containing EGF-like domains [Source:UniProtKB/TrEMBL;Acc:B0V3W1]
Human Orthologue:
VWDE
Human Description:
von Willebrand factor D and EGF domains [Source:HGNC Symbol;Acc:21897]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12831 Nonsense Available for shipment Available now
sa43797 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43796 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16549 Nonsense Available for shipment Available now
sa958 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa12831
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033332 Nonsense 712 1983 12 32
ENSDART00000133365   None 255 None 9
Genomic Location (Zv9):
Chromosome 22 (position 14378347)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14209254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTAANNNAGATGAAAGGTGCTAAACTGAAGTCTCAGTTGTCCAGTGGTT[T/A]GGCAGACAACTCTCTCTCTGTCAGGGAATTGGAATTGGACTCATTATYTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43797
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033332 Essential Splice Site 1015 1983 15 32
ENSDART00000133365   None 255 None 9
Genomic Location (Zv9):
Chromosome 22 (position 14359551)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14190559
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCACACAGCATTAGTATCTAAACCTAATCTCTCTTTTTCTTCTTCA[G/T]GTGACTAATGATGGACAGCAGTACAGCGATGGCAAGATTTTAACCCTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033332 Essential Splice Site 1048 1983 15 32
ENSDART00000133365   None 255 None 9
Genomic Location (Zv9):
Chromosome 22 (position 14359447)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14190455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTATTTGCCAGATATGTGTGGCTCCTTCTGGAATTTGTAAACTTAAGG[T/A]AATCATATACTCAAAGGCTTATGAGAAACAGAATTCATTTTTTATTTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16549
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033332 Nonsense 1624 1983 22 32
ENSDART00000133365   None 255 None 9
Genomic Location (Zv9):
Chromosome 22 (position 14307724)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14138732
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCCCAGGAGAGSTTCACCTACCTTGGTGAACAAAGCCACACCAAGTCTT[T/A]GAGCAACCAACCAGMTCTTGAGAAAGGTAGACACCCAAGCAAAACCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa958
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033332 Essential Splice Site 1913 1983 30 32
ENSDART00000133365 Essential Splice Site 185 255 7 9
Genomic Location (Zv9):
Chromosome 22 (position 14292245)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 14123353
KASP Assay ID:
554-0863.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCAGCTGTGTGGGAATTAAATAACAGTGTGCGTGTTTGTGTTTCTCCA[G/A]CGGTGTGTGTGCAGAAGTGTGTGAATGGTGGTGAGTGTGTGGGGCCGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link