si:ch211-106g4.2

Ensembl ID:
ENSDARG00000011672
ZFIN ID:
ZDB-GENE-081105-78
Description:
semaphorin-3B [Source:RefSeq peptide;Acc:NP_001121818]
Mouse Orthologue:
Sema3b
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3B Gene [Source:

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2422 Nonsense F2 line generated During 2017
sa41225 Nonsense Mutation detected in F1 DNA During 2017
sa12992 Nonsense Available for shipment Available now
sa41224 Nonsense Mutation detected in F1 DNA During 2017
sa21310 Nonsense Available for shipment Available now
sa6101 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2422
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 35 781 1 18
ENSDART00000027301 Nonsense 35 775 1 17
ENSDART00000062608   None 272 None 8
Genomic Location (Zv9):
Chromosome 8 (position 27461919)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26589837
KASP Assay ID:
554-2700.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCATTGAGCGGAAGCTCACAATCCTCACCCCGGATGAAACTGTCTYA[T/G]AAAGGTAGTGCACTATATCWAATSCCTGTTATTTTATTCYCAGGTTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 116 781 4 18
ENSDART00000027301 Nonsense 116 775 4 17
ENSDART00000062608   None 272 None 8
Genomic Location (Zv9):
Chromosome 8 (position 27448664)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26576582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTGTGCATGTGTGTGTGTGTGTGTGTTGCAGACGGATTGCGTAAACTA[T/A]GTGAAAGTGCTACACCACTATAATCGAACTCACCTATACGCCTGTGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12992
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 123 781 4 18
ENSDART00000027301 Nonsense 123 775 4 17
ENSDART00000062608   None 272 None 8
Genomic Location (Zv9):
Chromosome 8 (position 27448643)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26576561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGTTGCAGACGGATTGCGTRAACTAYGTRAAAGTGCTACACCACTA[T/G]AATCGAACTCACCTRTAYGCCTGTGGTACGGRGGCTTTCCACCCCACCYG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 353 781 10 18
ENSDART00000027301 Nonsense 353 775 10 17
ENSDART00000062608   None 272 None 8
Genomic Location (Zv9):
Chromosome 8 (position 27446260)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26574178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTGCAGTGTGTCTCTATACTATGAACGACATTCGCCGAGCATTTTTA[G/T]GACCTTTTGCCCATAAAGAGGGACCCAATTACCAGTGGATTCCATTCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 483 781 12 18
ENSDART00000027301 Nonsense 482 775 12 17
ENSDART00000062608 Nonsense 96 272 2 8
Genomic Location (Zv9):
Chromosome 8 (position 27444098)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26572016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAAGCTGGAGCAACACTGAGCTGCTGCTGGAGGAGCTGCACGTCTTT[A/T]AGGTGAACACAAAAATGTGTGGCTTTTATTTAGAGGGATAACATAAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015985 Nonsense 519 781 14 18
ENSDART00000027301 Nonsense 518 775 14 17
ENSDART00000062608 Nonsense 132 272 4 8
Genomic Location (Zv9):
Chromosome 8 (position 27442352)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 26570270
KASP Assay ID:
554-3925.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTCAGACACAGGTGTTGTCCAGGTGCCTCTGCACCGCTGCAGTWTGTA[C/A]GGTAAAGCYTGTGCCGAGTGCTGTTTGGCTCGAGATCCGTACTGCGCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link