msh6

Ensembl ID:
ENSDARG00000011666
ZFIN ID:
ZDB-GENE-020905-3
Description:
DNA mismatch repair protein Msh6 [Source:RefSeq peptide;Acc:NP_878280]
Human Orthologue:
MSH6
Human Description:
mutS homolog 6 (E. coli) [Source:HGNC Symbol;Acc:7329]
Mouse Orthologue:
Msh6
Mouse Description:
mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu1811 Nonsense Available for shipment Available now
sa12638 Nonsense Available for shipment Available now
sa22382 Nonsense Mutation detected in F1 DNA During 2014
sa15374 Nonsense Available for shipment Available now
sa15299 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
hu1811
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018840 Nonsense 474 1369 4 10
ENSDART00000143175 None None 109 None 3
ENSDART00000143315 None None 234 None 3
ENSDART00000146105 None None 129 None 4
Genomic Location:
Chromosome 13 (position 49394373)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGGCTTCCCTGAAATCGGCTTCGGCCGCTTCTCAGACGTACTTGTG[C/T]AAAAAGGCTACAAAGTAGCTCGCGTAGAACAGACTGAAACTCCAGATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018840 Nonsense 911 1369 4 10
ENSDART00000143175 None None 109 None 3
ENSDART00000143315 None None 234 None 3
ENSDART00000146105 None None 129 None 4
Genomic Location:
Chromosome 13 (position 49393062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGACTGAAAACGAAGATGGTCTTTTCCCTGACCTTTCTCCAGAGCTC[A/T]AACGTTGGGATACTGCTTTCGACCATCAGAAAGCTCGCACTACAGGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018840 Nonsense 938 1369 4 10
ENSDART00000143175 None None 109 None 3
ENSDART00000143315 None None 234 None 3
ENSDART00000146105 None None 129 None 4
Genomic Location:
Chromosome 13 (position 49392979)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCGCACTACAGGTGTCATCACACCAAAAGCTGGCTTCGATCCAGAATA[C/A]GACCAGGCCTTAAATGGAATAAAAGAGTGCGAGAGAGACCTGCAGGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15374
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018840 Nonsense 1004 1369 4 10
ENSDART00000143175 None None 109 None 3
ENSDART00000143315 None None 234 None 3
ENSDART00000146105 None None 129 None 4
Genomic Location:
Chromosome 13 (position 49392782)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAGAAGCCTACCGGARGAGTAYGAGGTCAGGTCTACTAAAAAGGGCT[G/A]GAAGCGATACTCYACCAAGGATATCGAGCGAWTGTTTTCAGAGCTACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15299
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018840 Essential Splice Site 1343 1369 9 10
ENSDART00000143175 None None 109 None 3
ENSDART00000143315 None None 234 None 3
ENSDART00000146105 None None 129 None 4
Genomic Location:
Chromosome 13 (position 49385372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGGCCCGCGACTTCGAAAGGAGCACCGTATCTCTCCGCATATTCAAG[T/A]ACGTCTCTTYATCAACATGTTTTACATCGTGATCWTTTYATTGCCTTAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sefgpzc9