chuk

Ensembl ID:
ENSDARG00000011662
ZFIN ID:
ZDB-GENE-040426-1069
Description:
Inhibitor of nuclear factor kappa-B kinase subunit alpha [Source:UniProtKB/Swiss-Prot;Acc:Q4G3H4]
Human Orthologue:
CHUK
Human Description:
conserved helix-loop-helix ubiquitous kinase [Source:HGNC Symbol;Acc:1974]
Mouse Orthologue:
Chuk
Mouse Description:
conserved helix-loop-helix ubiquitous kinase Gene [Source:MGI Symbol;Acc:MGI:99484]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35487 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35488 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027428 Essential Splice Site 159 758 6 22
Genomic Location (Zv9):
Chromosome 13 (position 25590725)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25236385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGATCTCAAGCCAGAGAATATTGTGCTGCAAGAAATTAATGGAAAGG[T/C]ATTTACTTTTTAGTGGTTAGAATTTTATTCTATAGACATGCTTTTCAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027428 Essential Splice Site 504 758 14 22
Genomic Location (Zv9):
Chromosome 13 (position 25596143)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 25241803
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGTACGACTTGGAGAAATACAGTGATCAGATGCAGTATGGCATATG[T/A]ACGTTTTTGAATATGCTGCTTTGTTGATAAAGCTAAAAATGTGTTATTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link