twf1b

Ensembl ID:
ENSDARG00000011661
ZFIN ID:
ZDB-GENE-040711-3
Description:
twinfilin, actin-binding protein, homolog 1b [Source:RefSeq peptide;Acc:NP_001002304]
Human Orthologue:
TWF1
Human Description:
twinfilin, actin-binding protein, homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:9620]
Mouse Orthologue:
Twf1
Mouse Description:
twinfilin, actin-binding protein, homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1100520]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11093 Essential Splice Site Available for shipment Available now
sa14476 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11093
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015134 Essential Splice Site 294 349 8 9
ENSDART00000129518 Essential Splice Site 320 375 8 9

The following transcripts of ENSDARG00000011661 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 13261113)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCATAGACACTGTRRAGAGAAACTTGGGCATTGAAATTGYCAAAAAG[G/A]TATTGCATGTTACTTTAGTATAAAGTTCAGCATACGCCATGCTGTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14476
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015134 Nonsense 333 349 9 9
ENSDART00000129518 Nonsense 359 375 9 9

The following transcripts of ENSDARG00000011661 do not overlap with this mutation:

Genomic Location:
Chromosome 4 (position 13259329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACATGCGCACAAGCAAGCTTTTGCCAAACCCAAGGGGCCAACAGGGAAA[A/T]GAGGAGGCCGTCGAATCACACGGGCACCAGGGGACGGCGGCGACGATGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3mf6svxx