si:ch211-93f2.1

Ensembl ID:
ENSDARG00000011636
ZFIN ID:
ZDB-GENE-041014-96
Description:
Novel carboxylesterase domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q5RGB1]
Human Orthologues:
CES1, CES2, CES3, CES4A, CES5A
Human Descriptions:
carboxylesterase 1 [Source:HGNC Symbol;Acc:1863]
carboxylesterase 2 [Source:HGNC Symbol;Acc:1864]
carboxylesterase 3 [Source:HGNC Symbol;Acc:1865]
carboxylesterase 4A [Source:HGNC Symbol;Acc:26741]
carboxylesterase 5A [Source:HGNC Symbol;Acc:26459]
Mouse Orthologues:
AC166833.1, Ces1a, Ces1b, Ces1c, Ces1d, Ces1e, Ces1f, Ces1g, Ces1h, Ces2a, Ces2b, Ces2c, Ces2d-ps, Ces2e, Ces2f, Ces2g, Ces3a, Ces3b, Ces4a, Ces5a, Ces5a
Mouse Descriptions:
carboxyesterase 2B Gene [Source:MGI Symbol;Acc:MGI:2448547]
carboxylesterase 1A Gene [Source:MGI Symbol;Acc:MGI:3648919]
carboxylesterase 1B Gene [Source:MGI Symbol;Acc:MGI:3779470]
carboxylesterase 1C Gene [Source:MGI Symbol;Acc:MGI:95420]
carboxylesterase 1D Gene [Source:MGI Symbol;Acc:MGI:2148202]
carboxylesterase 1E Gene [Source:MGI Symbol;Acc:MGI:95432]
carboxylesterase 1F Gene [Source:MGI Symbol;Acc:MGI:2142687]
carboxylesterase 1G Gene [Source:MGI Symbol;Acc:MGI:88378]
carboxylesterase 1H Gene [Source:MGI Symbol;Acc:MGI:1922954]
carboxylesterase 2A Gene [Source:MGI Symbol;Acc:MGI:2142491]
carboxylesterase 2C Gene [Source:MGI Symbol;Acc:MGI:2385905]
carboxylesterase 2D, pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:3704319]
carboxylesterase 2E Gene [Source:MGI Symbol;Acc:MGI:2443170]
carboxylesterase 2F Gene [Source:MGI Symbol;Acc:MGI:1919153]
carboxylesterase 2G Gene [Source:MGI Symbol;Acc:MGI:1919611]
carboxylesterase 3A Gene [Source:MGI Symbol;Acc:MGI:102773]
carboxylesterase 3B Gene [Source:MGI Symbol;Acc:MGI:3644960]
carboxylesterase 4A Gene [Source:MGI Symbol;Acc:MGI:2384581]
carboxylesterase 5A Gene [Source:MGI Symbol;Acc:MGI:1915185]
carboxylesterase 5A Gene [Source:MGI Symbol;Acc:MGI:1915185]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38108 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44336 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24706 Nonsense Available for shipment Available now
sa16141 Essential Splice Site Available for shipment Available now
sa14596 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104492 Essential Splice Site 759 1657 17 37
ENSDART00000147166 Essential Splice Site 759 962 17 23
Genomic Location (Zv9):
Chromosome 25 (position 31381125)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29948199
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGACCGTCTTTGGAGAGTCTGCTGGAGGAGTCAGTGCGTCTTTACTTG[T/C]AAGGATTTACACACAACGTCTAAACAAGTCAATTCTGTTAATCATCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104492 Essential Splice Site 952 1657 22 37
ENSDART00000147166 Essential Splice Site 952 962 22 23
Genomic Location (Zv9):
Chromosome 25 (position 31375681)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29942755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTTCTTTTTCAACCTCCCAGCTCGCAAATTAGCGAATTACCACAGAGG[T/G]AAAGTTCACCGTTTTTACGCACATTTATAAATAAAAAAATGGTTATGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104492 Nonsense 1170 1657 26 37
ENSDART00000147166   None 962 None 23
Genomic Location (Zv9):
Chromosome 25 (position 31373234)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29940398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTAGGTGTGCCGTTCGCCAAGCCGCCTGTAGGACCCCTGAGACTTGCT[C/T]GACCACAGGCTGCAGAGAAATGGCAAGGAGTTAGAGATGCCACCAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104492 Essential Splice Site 1401 1657 31 37
ENSDART00000147166   None 962 None 23
Genomic Location (Zv9):
Chromosome 25 (position 31370358)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29937522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCATYATGCACTGGTCTGAAGAGGAGGCTCTGGAATGTGCTAAAAAGG[T/C]TGGARATAATTTGTTAAAATCCACATGAGAAAGACATATRCACATACGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104492 Nonsense 1645 1657 37 37
ENSDART00000147166   None 962 None 23
Genomic Location (Zv9):
Chromosome 25 (position 31352868)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 29920032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAAAACYTTAAGCACAAACACTAYGAGTTCATGACCAAGACTCTTCCA[G/T]AACTCATACGTCAAGGAAAAACCAAGCACTCAGAACTGTAAAANNNNNNN
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link