LOC557046

Ensembl ID:
ENSDARG00000011618
Human Orthologue:
SLC26A2
Human Description:
solute carrier family 26 (sulfate transporter), member 2 [Source:HGNC Symbol;Acc:10994]
Mouse Orthologue:
Slc26a2
Mouse Description:
solute carrier family 26 (sulfate transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:892977]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14764 Nonsense Available for shipment Available now
sa22478 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024499 Nonsense 26 699 1 3
Genomic Location (Zv9):
Chromosome 14 (position 26454233)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25147435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCAGCAGAGGAAGATGCTAAAASAGAACCAAAKCTTCCCTTCCGTT[T/A]AGAAGAGTGCGTAAAAGAGAAAGTATCATGGAAGGAAGCGTTAAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024499 Nonsense 545 699 3 3
Genomic Location (Zv9):
Chromosome 14 (position 26450605)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 25143807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCATACAATGGACTTCAGACCCAACCAGATGTGGCTGTTTTCCGATA[C/A]GAGGCTCCCATCTACTACGCCAACCAAAGTCTGTTTAAAAAGTCGCTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link