LOC557046

Ensembl ID:
ENSDARG00000011618
Human Orthologue:
SLC26A2
Human Description:
solute carrier family 26 (sulfate transporter), member 2 [Source:HGNC Symbol;Acc:10994]
Mouse Orthologue:
Slc26a2
Mouse Description:
solute carrier family 26 (sulfate transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:892977]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14764 Nonsense Available for shipment Available now
sa4561 Nonsense Mutation detected in F1 DNA During 2014
sa22478 Nonsense Mutation detected in F1 DNA During 2014
sa4560 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024499 Nonsense 26 699 1 3
Genomic Location:
Chromosome 14 (position 26454233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTCAGCAGAGGAAGATGCTAAAASAGAACCAAAKCTTCCCTTCCGTT[T/A]AGAAGAGTGCGTAAAAGAGAAAGTATCATGGAAGGAAGCGTTAAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4561
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024499 Nonsense 265 699 2 3
Genomic Location:
Chromosome 14 (position 26453419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAAACTTGGATCAGTCTATTTAAGAATCTGGGTCATACCAACCTGTG[T/A]GACCTCATAACCAGCTTGATCTGCTTGCTTGTACTTGTTCCTGCCAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22478
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024499 Nonsense 545 699 3 3
Genomic Location:
Chromosome 14 (position 26450605)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCATACAATGGACTTCAGACCCAACCAGATGTGGCTGTTTTCCGATA[C/A]GAGGCTCCCATCTACTACGCCAACCAAAGTCTGTTTAAAAAGTCGCTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024499 Nonsense 562 699 3 3
Genomic Location:
Chromosome 14 (position 26450554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGCTCCCATCTACTACGCCAACCAAAGTCTGTTTAAAAAGTCRCTCTA[T/A]CGCAATGTAGGCCTGGATCCACTTAAAGAGAAAGCAAAACAAAGGAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4wdwgavm