mybpc3

Ensembl ID:
ENSDARG00000011615
ZFIN ID:
ZDB-GENE-070112-2362
Description:
myosin binding protein C, cardiac [Source:RefSeq peptide;Acc:NP_001037814]
Human Orthologue:
MYBPC3
Human Description:
myosin binding protein C, cardiac [Source:HGNC Symbol;Acc:7551]
Mouse Orthologue:
Mybpc3
Mouse Description:
myosin binding protein C, cardiac Gene [Source:MGI Symbol;Acc:MGI:102844]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7070 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7070
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099785 Essential Splice Site 185 371 None 11
ENSDART00000099789 None None 524 None 10
ENSDART00000122506 Essential Splice Site 185 363 None 10
ENSDART00000138491 None None 204 None 3
ENSDART00000139899 Essential Splice Site 185 1276 None 30
ENSDART00000144679 Essential Splice Site 95 122 None 4
Genomic Location:
Chromosome 7 (position 33182342)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTGAAAGTGAATACAAATGGWAAAACTTACAATCTTTTCTTCCCATTW[A/C]GGTGAAAACATTATTTTCATTGCTCGGGTGTGTGGTGAGTCTYTGCTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v9c7nc98