rbm39a

Ensembl ID:
ENSDARG00000011613
ZFIN ID:
ZDB-GENE-040426-2852
Description:
RNA-binding protein 39 [Source:RefSeq peptide;Acc:NP_001012304]
Human Orthologue:
RBM39
Human Description:
RNA binding motif protein 39 [Source:HGNC Symbol;Acc:15923]
Mouse Orthologue:
Rbm39
Mouse Description:
RNA binding motif protein 39 Gene [Source:MGI Symbol;Acc:MGI:2157953]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21905 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21905
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017973 Essential Splice Site 174 523 None 16
ENSDART00000131365   None 38 None 5
ENSDART00000133679 Essential Splice Site 152 203 None 8
ENSDART00000135435 Essential Splice Site 174 523 None 17
ENSDART00000138314   None 41 None 8

The following transcripts of ENSDARG00000011613 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 11 (position 25276568)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24105393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAATCCGGCCACGAGACCTAGAAGAATTCTTTTCTGCAGTTGGAAAAG[T/A]CTGTTTGTTTCACTTTGGACAACTTTGACCCGTTTCCCCACTAAGCTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link