actr1

Ensembl ID:
ENSDARG00000011611
ZFIN ID:
ZDB-GENE-040426-2695
Description:
beta-centractin [Source:RefSeq peptide;Acc:NP_998537]
Human Orthologue:
ACTR1B
Human Description:
ARP1 actin-related protein 1 homolog B, centractin beta (yeast) [Source:HGNC Symbol;Acc:168]
Mouse Orthologue:
Actr1b
Mouse Description:
ARP1 actin-related protein 1 homolog B, centractin beta (yeast) Gene [Source:MGI Symbol;Acc:MGI:1917

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6183 Nonsense Mutation detected in F1 DNA During 2016
sa31803 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010420 Nonsense 100 376 4 11
ENSDART00000075303 Nonsense 100 343 4 10
Genomic Location (Zv9):
Chromosome 10 (position 43891417)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42697912
KASP Assay ID:
554-5147.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACGACATGGAGCGCATCTGGCAGTACGTGTACTCGAAGGAGCAGCTG[C/T]AGACCTTCTCTGAGGAGGTGAGCATGTGCTTCTTCTACAGTTTGCTTYAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010420 Essential Splice Site 250 376 7 11
ENSDART00000075303 Essential Splice Site 250 343 7 10
Genomic Location (Zv9):
Chromosome 10 (position 43897442)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42703937
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAACTGAAAAAGCACAGTATACCCTCCCTGACGGAAGCACTCTAGATG[T/A]AAGAATGATTTTATCAGTATTACATTTCCAGTAATTTAAATAAGAAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link