fam116b

Ensembl ID:
ENSDARG00000011605
ZFIN ID:
ZDB-GENE-030131-9382
Description:
family with sequence similarity 116, member B [Source:RefSeq peptide;Acc:NP_956359]
Human Orthologue:
FAM116B
Human Description:
family with sequence similarity 116, member B [Source:HGNC Symbol;Acc:32690]
Mouse Orthologue:
Fam116b
Mouse Description:
family with sequence similarity 116, member B Gene [Source:MGI Symbol;Acc:MGI:1916690]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8165 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20263 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024647 Essential Splice Site 64 575 2 20
Genomic Location:
Chromosome 4 (position 19015575)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTCCTCAGCTTGTTTACCCTCATGATGTCAAACTCACAGAAAAGGAGG[T/C]AAGTGCRMATTAATTAAAATCATTTACCTTTTTTTNATTACCAGCTACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024647 Essential Splice Site 318 575 11 20
Genomic Location:
Chromosome 4 (position 19011765)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATTCATGACAGTGAATTCAAGGAATACACCACCAGGACTCAGGCTCC[G/A]TAAGCAAAAAAGCACTACACTTTACAGTCTTTCTCTAAAGCGATCATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6lhy18f0