fam116b

Ensembl ID:
ENSDARG00000011605
ZFIN ID:
ZDB-GENE-030131-9382
Description:
family with sequence similarity 116, member B [Source:RefSeq peptide;Acc:NP_956359]
Human Orthologue:
FAM116B
Human Description:
family with sequence similarity 116, member B [Source:HGNC Symbol;Acc:32690]
Mouse Orthologue:
Fam116b
Mouse Description:
family with sequence similarity 116, member B Gene [Source:MGI Symbol;Acc:MGI:1916690]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20263 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20263
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024647 Essential Splice Site 318 575 11 20
Genomic Location (Zv9):
Chromosome 4 (position 19011765)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20088371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATTCATGACAGTGAATTCAAGGAATACACCACCAGGACTCAGGCTCC[G/A]TAAGCAAAAAAGCACTACACTTTACAGTCTTTCTCTAAAGCGATCATTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link