olfcg1

Ensembl ID:
ENSDARG00000011604
ZFIN ID:
ZDB-GENE-060503-630
Description:
7 transmembrane receptor (metabotropic glutamate family) protein [Source:RefSeq peptide;Acc:NP_0011
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31976 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067574 Essential Splice Site 535 840 5 6
Genomic Location (Zv9):
Chromosome 14 (position 17757560)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32869825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTATGACTGCATTCCATGTGCAGAAGGAGAAATCAGTAATGAAACGG[G/T]TAAGCTTCAGTTCATCTCAACACTTCAAAGAAAACTGGTAAGCTGTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link