epha4b

Ensembl ID:
ENSDARG00000011600
ZFIN ID:
ZDB-GENE-030826-6
Description:
eph receptor A4b [Source:RefSeq peptide;Acc:NP_705944]
Human Orthologue:
EPHA4
Human Description:
EPH receptor A4 [Source:HGNC Symbol;Acc:3388]
Mouse Orthologue:
Epha4
Mouse Description:
Eph receptor A4 Gene [Source:MGI Symbol;Acc:MGI:98277]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13595 Splice Site, Nonsense Available for shipment Available now
sa39899 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007709 Splice Site, Nonsense 661 923 11 15
ENSDART00000037292 Splice Site, Nonsense 714 976 15 19
Genomic Location (Zv9):
Chromosome 2 (position 40252987)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 40646177
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATATAATTAGTATTGCTCACACATTTGTCTTGTCTTTTCTCTTGCAG[A/T]AGCATGATGGGCAGTTCACAGTYATTCAGCTGGTGGGCATGATGCGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007709 Nonsense 813 923 13 15
ENSDART00000037292 Nonsense 866 976 17 19
Genomic Location (Zv9):
Chromosome 2 (position 40259640)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 40652830
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCCCCGTGGTCCTTCATCAGCTCATGCTGGACTGCTGGGAGAAAAGC[A/T]GAAGTGAACGGCCCAAATTCGGGCAGATCGTCAACACTCTTGACAAACTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Brain imaging: Whole genome association study of brain-wide imaging phenotypes for identifying quantitative trait loci in MCI and AD: A study of the ADNI cohort. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link