epha4b

Ensembl ID:
ENSDARG00000011600
ZFIN ID:
ZDB-GENE-030826-6
Description:
eph receptor A4b [Source:RefSeq peptide;Acc:NP_705944]
Human Orthologue:
EPHA4
Human Description:
EPH receptor A4 [Source:HGNC Symbol;Acc:3388]
Mouse Orthologue:
Epha4
Mouse Description:
Eph receptor A4 Gene [Source:MGI Symbol;Acc:MGI:98277]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13595 Splice Site, Nonsense Available for shipment Available now
sa5163 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13595
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007709 Splice Site, Nonsense 661 923 11 15
ENSDART00000037292 Splice Site, Nonsense 714 976 15 19
Genomic Location:
Chromosome 2 (position 40252987)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATATAATTAGTATTGCTCACACATTTGTCTTGTCTTTTCTCTTGCAG[A/T]AGCATGATGGGCAGTTCACAGTYATTCAGCTGGTGGGCATGATGCGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5163
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007709 Nonsense 738 923 12 15
ENSDART00000037292 Nonsense 791 976 16 19
Genomic Location:
Chromosome 2 (position 40257208)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATACTTTCTTTTATCTTTTCTTATTCAGGGTGGAAAAATCCCCATTCGAT[G/A]GACAGCCCCAGAGGCCATCGCGTACAGAAAGTTCACCTCAGCGAGTGACG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Brain imaging: Whole genome association study of brain-wide imaging phenotypes for identifying quantitative trait loci in MCI and AD: A study of the ADNI cohort. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i6lp785l