atxn2l

Ensembl ID:
ENSDARG00000011597
ZFIN ID:
ZDB-GENE-030131-3246
Description:
ataxin-2-like protein [Source:RefSeq peptide;Acc:NP_997849]
Human Orthologue:
ATXN2L
Human Description:
ataxin 2-like [Source:HGNC Symbol;Acc:31326]
Mouse Orthologue:
Atxn2l
Mouse Description:
ataxin 2-like Gene [Source:MGI Symbol;Acc:MGI:2446242]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1077 Essential Splice Site F2 line generated During 2014
sa25243 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa19965 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1077
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025971 Essential Splice Site 507 981 14 24
ENSDART00000133168 Essential Splice Site 530 1004 14 24
Genomic Location:
Chromosome 3 (position 15010999)
KASP Assay ID:
554-0979.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGATCACAAATCTCTGAGGAGCTTCGCAAGTTTGGTAATACTTTTAGG[G/A]TGAGTGTGCACGAATGTAATCTGCATCTAGGTTGTTTTCAATCACGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25243
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025971 Splice Site, Nonsense 769 981 19 24
ENSDART00000133168 Splice Site, Nonsense 792 1004 19 24
Genomic Location:
Chromosome 3 (position 15018578)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTACAGTACAACCAGGTCATCCCAGCAATGCCCCACTACCCTGGACAC[C/T]AAGTATGAGCTTCTACATTTGCATAAAATCAATACCTTTTTTTTATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19965
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025971 Essential Splice Site 964 981 None 24
ENSDART00000133168 Essential Splice Site 987 1004 None 24
Genomic Location:
Chromosome 3 (position 15029823)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTGTTTTACCTTCTGACTTTGATCATTTGTGTTTTTGTTCTGTGCTC[A/T]GTGCCAGTGCAGGCTCACAATCCCCAGCAGATTCCATATCACCCTTCTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Body mass index: Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/x0l1a9sz