cry1b

Ensembl ID:
ENSDARG00000011583
ZFIN ID:
ZDB-GENE-010426-3
Description:
cryptochrome 1b [Source:RefSeq peptide;Acc:NP_571865]
Human Orthologue:
CRY1
Human Description:
cryptochrome 1 (photolyase-like) [Source:HGNC Symbol;Acc:2384]
Mouse Orthologue:
Cry1
Mouse Description:
cryptochrome 1 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270841]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu893 Essential Splice Site Confirmed mutation in F2 line Unknown
hu892 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
hu893
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128609 Essential Splice Site 275 606 7 14
Genomic Location:
Chromosome 18 (position 14708803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCTCCTGTAGACTTTTCTATTTCAAACTAACAGACCTCTACAGGAAG[G/T]TAAAGATGACCTTGTTTTGACTTGTTAATCAAAGCAATATATGATAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu892
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128609 Nonsense 320 606 8 14
Genomic Location:
Chromosome 18 (position 14709044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACATTTTGACAAAATGGAGTTCAATCCCATCTGCGTGCAGATTCCAT[G/A]GGACAGGAACCCAGAGGCTCTGGCCAAGTGGGCCGAAGGTCAGACCGGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c80sph4o