cry1b

Ensembl ID:
ENSDARG00000011583
ZFIN ID:
ZDB-GENE-010426-3
Description:
cryptochrome 1b [Source:RefSeq peptide;Acc:NP_571865]
Human Orthologue:
CRY1
Human Description:
cryptochrome 1 (photolyase-like) [Source:HGNC Symbol;Acc:2384]
Mouse Orthologue:
Cry1
Mouse Description:
cryptochrome 1 (photolyase-like) Gene [Source:MGI Symbol;Acc:MGI:1270841]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36600 Nonsense Mutation detected in F1 DNA During 2016
hu893 Essential Splice Site Confirmed mutation in F2 line Unknown
hu892 Nonsense Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa36600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128609 Nonsense 100 606 4 14
Genomic Location:
Chromosome 18 (position 14705829)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCTCTCTATCTCTAGGAGTGGAAAATCAGCCGGCTGTCATACGAGTA[C/A]GACTCAGAGCCCTTCGGGAAGGATCGTGATGCAGCTATTAGGAAACTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu893
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128609 Essential Splice Site 275 606 7 14
Genomic Location:
Chromosome 18 (position 14708803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTCTCCTGTAGACTTTTCTATTTCAAACTAACAGACCTCTACAGGAAG[G/T]TAAAGATGACCTTGTTTTGACTTGTTAATCAAAGCAATATATGATAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu892
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128609 Nonsense 320 606 8 14
Genomic Location:
Chromosome 18 (position 14709044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACATTTTGACAAAATGGAGTTCAATCCCATCTGCGTGCAGATTCCAT[G/A]GGACAGGAACCCAGAGGCTCTGGCCAAGTGGGCCGAAGGTCAGACCGGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link