LOC100150225

Ensembl ID:
ENSDARG00000011581
Human Orthologues:
NLRP12, RNH1
Human Descriptions:
NLR family, pyrin domain containing 12 [Source:HGNC Symbol;Acc:22938]
ribonuclease/angiogenin inhibitor 1 [Source:HGNC Symbol;Acc:10074]
Mouse Orthologue:
Rnh1
Mouse Description:
ribonuclease/angiogenin inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1195456]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22700 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14954 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059786 Essential Splice Site 15 687 1 16
Genomic Location:
Chromosome 15 (position 35637411)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAATGGTGTTTCTGCACACCACTCATCTTTATTCAGGTCAAACAGAGG[T/A]AAGTGGGTATAAGGTAAAAATGTTTTTATCCTATTGGAACAACATGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059786 Essential Splice Site 175 687 4 16
Genomic Location:
Chromosome 15 (position 35634222)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCRCTGCTGGTCTGGAAAATTCTTYCWGCAAATTGGAGAAACTGAGG[T/G]AAGATTTAACACGAGTGCTGTATGCAATGGAAAATCAAGAATMCCATATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rpyfl39j