abcb11a

Ensembl ID:
ENSDARG00000011573
ZFIN ID:
ZDB-GENE-050517-13
Description:
Novel protein similar to vertebrate ATP-binding cassette, sub-family B (MDR/TAP), member 11 (ABCB11)
Human Orthologue:
ABCB11
Human Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 11 [Source:HGNC Symbol;Acc:42]
Mouse Orthologue:
Abcb11
Mouse Description:
ATP-binding cassette, sub-family B (MDR/TAP), member 11 Gene [Source:MGI Symbol;Acc:MGI:1351619]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18968 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18599 Essential Splice Site Available for shipment Available now
sa21601 Essential Splice Site Mutation detected in F1 DNA During 2014
sa3700 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa18968
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047401 Essential Splice Site 160 1281 5 25
ENSDART00000134566 Essential Splice Site 154 609 4 12
ENSDART00000139631 None None 635 None 12
Genomic Location:
Chromosome 9 (position 49816762)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTTGCATAGATACTAGTTTAATTTAGCATGTTTGTTACTTTTTTGCA[G/A]TGACATCAACAAAATCAACAACGCTATAGCGGACCAGGTGTCCATCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18599
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047401 Essential Splice Site 317 1281 7 25
ENSDART00000134566 Essential Splice Site 311 609 6 12
ENSDART00000139631 None None 635 None 12
Genomic Location:
Chromosome 9 (position 49824965)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACTGGTCATCGAGACCCAGGAGCKCACACCTGGAGGACTCGTTCAGG[T/G]AGAAATGACTCTCAGAATTTAATTTTTCTGTTCAAAACAAYATCTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047401 Essential Splice Site 559 1281 12 25
ENSDART00000134566 Essential Splice Site 553 609 11 12
ENSDART00000139631 None None 635 None 12
Genomic Location:
Chromosome 9 (position 49833688)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGCTGGATAATGAGAGTGAGGCTGTCGTACAGGAGGCCTTGGACAAG[G/A]TGAGACTAATGATATCCTCACCAGCTGATGCTAAAATATAACTTTGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3700
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047401 Nonsense 759 1281 17 25
ENSDART00000134566 None None 609 None 12
ENSDART00000139631 Nonsense 113 635 4 12
Genomic Location:
Chromosome 9 (position 49844229)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCTATTCCGGACCCGGATGACCAGAGGAGRCAGATAAATGGGATTTG[T/A]ATTTTGTTTGTGGTCATAGGAGTCRTAAGCTTCTTTTCACAGTTCTTACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lrficyvb