LOC567131

Ensembl ID:
ENSDARG00000011571
Human Orthologue:
CALCRL
Human Description:
calcitonin receptor-like [Source:HGNC Symbol;Acc:16709]
Mouse Orthologue:
Calcrl
Mouse Description:
calcitonin receptor-like Gene [Source:MGI Symbol;Acc:MGI:1926944]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33824 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000043908 Essential Splice Site 319 478 8 11
Genomic Location (Zv9):
Chromosome 6 (position 11612360)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 11465986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTCTCTGCTCTACATTATTCATGGGCCCATCTGTGCAGCTCTATTGG[T/C]AAGTCTGCTTTCTCTTTGCACTCTTTATTTCATTTTCTCACACTTTATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link