Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
LOC567131
- Ensembl ID:
- ENSDARG00000011571
- Human Orthologue:
- CALCRL
- Human Description:
- calcitonin receptor-like [Source:HGNC Symbol;Acc:16709]
- Mouse Orthologue:
- Calcrl
- Mouse Description:
- calcitonin receptor-like Gene [Source:MGI Symbol;Acc:MGI:1926944]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa33824 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa33824
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000043908 | Essential Splice Site | 319 | 478 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 6 (position 11612360)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 11465986 GRCz11 6 11701413 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTTCTCTGCTCTACATTATTCATGGGCCCATCTGTGCAGCTCTATTGG[T/C]AAGTCTGCTTTCTCTTTGCACTCTTTATTTCATTTTCTCACACTTTATCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
